|
Home :: Product Catalog :: DNA Sequencing
|
|
Detect. Discover. Identify.®
|
DNA Sequencing
|
|
|
Service Highlights
- Cycle sequencing using either a universal vector primer or a customer provided primer.
- BigDye© Terminator chemistry
- Automated sequencing on an ABI 3700 or 3100 sequencers
- Typically 550 – 600 basepairs of Phred 20 quality sequence dependent upon quality of template
- Report with original chromatograms in .ab1 file format and Phred quality scores.
- Automated assembly of sequences.
Service Description
BioVentures custom sequencing offers single primer extension service for plasmid or PCR products. This service includes standard universal primers:
|
| Universal Primer Name | Sequence |
| M13 Forward (-20) | GTAAAACGACGGCCAG |
| M13 Reverse | CAGGAAACAGCTATGAC |
| SP6 | ATTTAGGTGACACTATA |
| T3 | ATTAACCCTCACTAAAGGGA |
| T7 | TAATACGACTCACTATAGGG |
|
|
In addition, custom primers can be supplied by the customer to be used in cycle sequencing.
Turnaround Time
Samples can typically be processed in 48 hours, dependant on workload and arrival time of the samples.
Chromatogram Delivery
When sequencing is complete you will be notified to return to the website and retrieve your chromatograms. A username and password will be provided to protect your samples. Chromatograms will be compressed in one of several formats including:
- UNIX - .tar.gz
- Windows/MAC - .zip
Alternatively the chromatograms can be provided on compact disk.
Template Preparation
Templates should be cleaned prior to submission for sequencing using a high quality plasmid prep or PCR nucleotide digestion. Alternatively, BioVentures can clean PCR products for $1 per reaction. PCR product should be from a single band. The quality of your sequencing results depends upon the quality and concentration of your template. Please follow the table below to determine amount of template for 5 µl final volume.
|
| DNA Type | Size | Total Amount | DNA Concentration | Final Volume |
| Double strand plasmid | < 5k bp | 200ng | 40 ng/ul | 5 ul |
| Double strand plasmid | 5-10k bp | 300 ng | 60 ng/ul | 5 ul |
| Double strand plasmid | > 10k bp | 500 ng | 100 ng/ul | 5 ul |
| PCR product | <100-200 bp | 30 ng | 6 ng/ul | 5 ul |
| PCR product | 200-500 bp | 50 ng | 10 ng/ul | 5 ul |
| PCR product | 500-1000 bp | 70 ng | 14 ng/ul | 5 ul |
| PCR product | 1-2 kb | 100 ng | 20 ng/ul | 5 ul |
| PCR product | > 2 kb | treat as plasmid | | |
|
We recommend that over 24 or more samples be arrayed in a 96 well plate otherwise 200 µl PCR strip tubes can be used for smaller sample sizes. Please seal strip tubes with matching caps and plates with aluminum adhesive seals. An adequate seal is important to prevent sample loss.
Custom Primers
If you intend to use custom primers for sequencing you should send 5 µl at 1 µM concentration per reaction, in well labeled tubes. If supplying samples in plate format and using multiple custom primers please array primers in the same format as the samples.
|
| Primer size (bp) | ng/µl for 1 µM
final concentration |
| 18mer | 5.9 |
| 19mer | 6.2 |
| 20mer | 6.6 |
| 21mer | 6.9 |
| 22mer | 7.2 |
| 23mer | 7.6 |
| 24mer | 7.9 |
| 25mer | 8.2 |
|
Shipping
Samples may be frozen and sent overnight on dry ice or lyophilized and sent standard overnight service. Please make sure that the dry ice covers all of the plate and wrap the plates to protect them from shifting in the container. Please send samples to:
BioVentures, Inc.
Attention Sequencing Services
1435 Kensington Square Court
Murfreesboro, TN 37130
Pricing
- $10/sample up to 75 samples
- $750.00/96 well plate ($7.82/sample over 75 samples)
- $1/sample PCR template cleanup
- $0.50/sample PCR template cleanup over 75 samples
Bioinformatics Services
Bioinformatics services are available for an additional fee. They include:
- Phred/Phrap/PolyPhred for SNP analysis.
- BLAST
- Custom Database creation
Please call for pricing and additional information.
Online Ordering
You may download our form to configure your custom sequencing by
clicking here (file is in Excel xls format) (some browsers may require you to right-click and then select "save as"
for the file to be properly downloaded). After filling out the form, you may upload it and
add it to your cart by following this link. Once your sequences
are ready, you will be notified via email along with a link to retreive your sequence
information.
|
BigDye® is a trademark of Applied Biosystems.
|
